Genome Assembly

Tutorial

In this tutorial we will walk through assembling a smaller (6.8G bases) yeast genome using the SPAdes Genome Assembler.

NOTE: This tutorial assumes you are running either Linux and OS X. Refer to the SRA Toolkit Documentation for Windows instruction.

Download the demo data

1. Download the NCBI SRA Toolkit which allows for downloading the sequence data.
2. Follow the instructions for your operating system.
3. Run a test outlined in the instrucitons above to make sure its working as expected and you know how to run the commands. For example, Linux and OS X can run ./fastq-dump -X 5 -Z SRR390728 which just produce the following output.

   Read 5 spots for SRR390728
   Written 5 spots for SRR390728
   @SRR390728.1 1 length=72
   CATTCTTCACGTAGTTCTCGAGCCTTGGTTTTCAGCGATGGAGAATGACTTTGACAAGCTGAGAGAAGNTNC
   +SRR390728.1 1 length=72
   ;;;;;;;;;;;;;;;;;;;;;;;;;;;9;;665142;;;;;;;;;;;;;;;;;;;;;;;;;;;;;96&&&&(
   @SRR390728.2 2 length=72
   AAGTAGGTCTCGTCTGTGTTTTCTACGAGCTTGTGTTCCAGCTGACCCACTCCCTGGGTGGGGGGACTGGGT
   +SRR390728.2 2 length=72
   ;;;;;;;;;;;;;;;;;4;;;;3;393.1+4&&5&&;;;;;;;;;;;;;;;;;;;;;<9;<;;;;;464262
   @SRR390728.3 3 length=72
   CCAGCCTGGCCAACAGAGTGTTACCCCGTTTTTACTTATTTATTATTATTATTTTGAGACAGAGCATTGGTC
   +SRR390728.3 3 length=72
   -;;;8;;;;;;;,*;;';-4,44;,:&,1,4'./&19;;;;;;669;;99;;;;;-;3;2;0;+;7442&2/
   @SRR390728.4 4 length=72
   ATAAAATCAGGGGTGTTGGAGATGGGATGCCTATTTCTGCACACCTTGGCCTCCCAAATTGCTGGGATTACA
   +SRR390728.4 4 length=72
   1;;;;;;,;;4;3;38;8%&,,;)*;1;;,)/%4+,;1;;);;;;;;;4;(;1;;;;24;;;;41-444//0
   @SRR390728.5 5 length=72
   TTAAGAAATTTTTGCTCAAACCATGCCCTAAAGGGTTCTGTAATAAATAGGGCTGGGAAAACTGGCAAGCCA
   +SRR390728.5 5 length=72
   ;;;;;;;;;;;;;;;;;;;;;;;;;;;;;9445552;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;446662
   

4. Create a data directory for downloading data with the command mkdir data && cd $_.
5. Download the Demo data with the command ../sratoolkit.2.8.2-1-mac64\ 2/bin/fastq-dump --split-files --gzip ERR1294016. This assumes you are in the data directory and your fastq-dump is in the path designated. You will end up with two files ERR1294016_1.fastq.gz and ERR1294016_2.fastq.gz for each read.

   NOTE: This will take awhile! Its downloading ~3.3G bytes per file.

Checking the quality of the high throughput sequencing

1. Download FastQC application and run it interactively (GUI) by following these instructions or download the Win/Linux zip file to follow along below.

   NOTE: If you don't have Java JDK installed you will need to download and install it before running FastQC.

2. Create a directory for the QC report mkdir ../fastqc_report
3. Run FastQC to generate the report assuming you are still in your data directory by running ../FastQC/fastqc ERR1294016_1.fastq.gz ERR1294016_2.fastq.gz -o ../fastqc_report. This will take several minutes to complete and produce a report in the fastqc_report directory. There are several resources online on how to read a FastQC report such as this video.

Assembling the Genome

1. Download the SPAdes assembler.
2. Before you attempt assembly its a good diea to verify SPAdes was installed correctly by running ../SPAdes-3.11.1-Darwin/bin/spades.py --test and you should get a ========= TEST PASSED CORRECTLY. at the end. For more information see the documentation.
3. Create a directory for the assembly mkdir ../assembly
4. Run the assembler with the command ../SPAdes-3.11.1-Darwin/bin/spades.py -o ../assembly -1 ERR1294016_1.fastq.gz -2 ERR1294016_2.fastq.gz

   NOTE: This will take a long time ~10hrs depending on your system specs.